Part:BBa_K3338001

Human codon optimized Gaussia luciferase hGLuc

Usage and Biology

Gaussia luciferase from the copepod Gaussia princeps has a molecular weight of 19.9 kDa and catalyzes the oxidative decarboxylation of coelenterazine to produce coelenteramide and light and therewith generates a bioluminescent signal (Verhaegent and Christopoulos 2002). It is a naturally secreted protein with a N-terminal signal peptide making it well-suited as a reporter gene for many cell culture applications (Verhaegent and Christopoulos 2002, Tannous et al. 2005). In this study we used a human codon optimized form previously described in Tannous et al. In the original study it was shown that hGLuc generates over 1000-fold higher bioluminescent signal intensities than humanized forms of firefly luciferase and Renilla luciferase when expressed in mammalian cells (Tannous et al. 2005). Apart from cell culture experiments hGLuc was also utilized for in vivo studies in mice where it was used to localize and measure the expansion of transplanted hGLuc expressing cells using bioluminescence imaging (Tannous et al. 2005). In other studies, hGLuc could be detected in blood and urine samples of transplanted cells making hGLuc very well-suited as a reporter for many applications (Tannous 2009).

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Characterization

To characterize this part, we cloned it into pEGFP-C2 (BBa_K3338020) right behind the CMV promoter. Therefore, we PCR amplified hGLuc from the Addgene plasmid #22522 (Pastrana et al. 2009) using the specific primers shown in table 1. The vector was cut with the NheI and BamHi to remove the EGFP-gene. The PCR product and the linearized vector were assembled using the NEBuilder® HiFi DNA Assembly Cloning kit from NEB and subsequently sequence verified. The product is shown in figure 1.

Table1: Primers used to design the fragment.

Primer name	Sequence
hGLuc_fw	TCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGATGGGAGTCAAAGTTCTGTTTGCC
hGLuc_rw	TGTGGTATGGCTGATTATGATCAGTTATCTAGATCCGGTGTTAGTCACCACCGGCCCCCT

Figure 1: Cloning of CMV-hGLuc into pEGFP-C2. A, 1 % agarose gel of the hGLuc PCR product. The Addgene plasmid #22522 was used as template. The primers are listed in table 1. B, Vector map of CMV-hGLuc in pEGFP-C2.

The product was transfected in HeLa cells by lipofection (ViaFect transfection reagent) or electroporation. The expression and activity of hGLuc was assessed using a luminescence assay with the supernatant of the cells. For that the enzyme’s substrate coelenterazine was added to the cell culture supernatant. Since luminescence is produced in the reaction of Gaussia luciferase with its substrate, we qualitatively detected the enzyme’s expression via camera. Figure 2 displays that bioluminescence was only observed in cells transfected with the CMV-hGLuc construct but not in non-transfected cells indicating expression und proper folding of the protein. Due to the fact, that we only used the supernatant for chemiluminescence detection, it was clearly shown that the protein is properly secreted as expected. In further experiments we showed that hGluc can be used to determine and compare the strength of different promoters (see BBa_K3338002 and BBa_K3338007).

References

Pastrana, D. V., Tolstov, Y. L., Becker, J. C., Moore, P. S., Chang, Y., & Buck, C. B. (2009). Quantitation of human seroresponsiveness to Merkel cell polyomavirus. PLoS pathogens, 5(9), e1000578.

Tannous, B. A., Kim, D. E., Fernandez, J. L., Weissleder, R., & Breakefield, X. O. (2005). Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo. Molecular therapy: the journal of the American Society of Gene Therapy, 11(3), 435–443.

Tannous B. A. (2009). Gaussia luciferase reporter assay for monitoring biological processes in culture and in vivo. Nature protocols, 4(4), 582–591.

Verhaegent, M., & Christopoulos, T. K. (2002). Recombinant Gaussia luciferase. Overexpression, purification, and analytical application of a bioluminescent reporter for DNA hybridization. Analytical chemistry, 74(17), 4378–4385.